Primer3 Input May 2026

It signals "end of input" to Primer3. Running It (Command Line) primer3_core < my_primers.txt > my_primers_output.txt Debugging Common Input Errors | Error Message | Likely Fix | | :--- | :--- | | Sequence is shorter than product range | Your SEQUENCE_TEMPLATE is too short. Add flanking bases. | | No valid primers found | Your Tm range is too narrow, or SEQUENCE_TARGET is too close to the end of the template. | | No left primer found | Check PRIMER_MAX_POLY_X or PRIMER_MIN_GC . You are being too strict. | Final Takeaway Primer3 is not a mystery. It is a declarative engine . You define the landscape (sequence) and the constraints (Tm, size, target), and it calculates the best path through the DNA.

Next time you are frustrated that "no primers were found," don't tweak the sequence—. Loosen the Tm range by 1°C or extend the product size range. The perfect primer pair is always just a parameter change away. Have a tricky multiplexing scenario? Drop the parameters in the comments below.

PRIMER_MIN_SIZE=18 PRIMER_OPT_SIZE=20 PRIMER_MAX_SIZE=25 primer3 input

If you have ever used an online primer design tool, chances are you were using under the hood. Written in C and later wrapped in Python (Primer3-py) or web interfaces (Primer3Plus), this engine is the gold standard for picking oligonucleotides.

Today, we are tearing down the primer3_core input file. Primer3 input is plain text. It uses a simple KEY=VALUE syntax. The engine reads these parameters, processes the sequence, and spits out the best primers. It signals "end of input" to Primer3

PRIMER_MAX_POLY_X=4 # Max mononucleotide repeats (e.g., AAAA) PRIMER_GC_CLAMP=1 # Require G or C in last 5 bases of 3' end PRIMER_MAX_SELF_ANY=4.0 PRIMER_MAX_SELF_END=3.0 PRIMER_NUM_RETURN=5

PRIMER_PRODUCT_SIZE_RANGE=150-250 PRIMER_PRODUCT_OPT_SIZE=200 | | No valid primers found | Your

SEQUENCE_ID=TP53_exon7_test SEQUENCE_TEMPLATE=GGACCTGGTCCTCTGACTGCTCTTTTCACCCATCTACAGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGGTCAGTTGCCCTGAGGGGCTGGCTTCCATGAGACTTCAT PRIMER_TASK=pick_pcr_primers SEQUENCE_TARGET=120,1